A reverse primer is a small piece of genetic material that helps scientists in the process of DNA sequencing. It is used to identify the starting point for copying or amplifying specific DNA segments.
Sentences with «reverse primer»
Templates for in situ hybridization probes were amplified by PCR from those plasmids by using the forward primers and reverse primers with or without a T3 promoter site (TATTAACCCTCACTAAAGGGAA) attached to their 5 ′ end. (journals.plos.org)
For the backward mutation of E82Q, overlapping primers were designed to introduce the reversion (rbc711 5 ′ GCATCCCCGACTTCTTTAAGcAGTCCTTCCCTGAGGGCTTCACATGGGAG 3 ′, rbc712 5 ′ AAGCCCTCAGGGAAGGACTgCTTAAAGAAGTCGGGGATGCCCTGGGTGTG 3 ′) creating two PCR products that were then used in ligation PCR with Amrose forward primer rbc710 5 ′ tacgctagcgccaccATGAGCGAGCTGATCAAGGAGAACATGCACA 3 ′ and reverse primer rbc664 5 ′ ttagatctTCATCTGTGCCCCAGTTTGCTAGGGAGGTCGC 3 ′. (journals.plos.org)
The 3 ′ end was recovered using a forward primer near the 3 ′ end of the genome and a reverse primer derived from 5 ′ - ITR sequence. (journals.plos.org)